Review




Structured Review

Tree Star Inc algorithms graphpad prism
Algorithms Graphpad Prism, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad/flowjo10/pm42268710-553-201-212
Average 86 stars, based on 1 article reviews
algorithms graphpad prism - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

Software:

Article Title: 5' UTR introns reduce nuclear transgene silencing and enable robust protein expression in Chlamydomonas reinhardtii.
Article Snippet: .. This paper N/A Software and algorithms GraphPad Prism version 9.5.1 GraphPad https://www.graphpad.com/ R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/downloads QuantStudioTM Design & Analysis Software Thermo Fisher https://www.thermofisher.cn/cn/zh/home/technical- resources/software-downloads/quantstudio-3-5real-time-pcr-systems.html Fiji Schindelin et al.34 https://imagej.net/software/fiji/downloads Other LSM 980 Confocal Microscope Zeiss LSM 980 BD LSR II flow cytometer BD biosciences N/A SapphireTM Biomolecular Imager Azure Biosystems N/A Cell Reports 45, 117424, June 23, 2026 13 ..

Article Title: Transplanting light-dependent reactions for mammalian eye photosynthesis.
Article Snippet: In brief Therapeutic delivery of LEAF, a chloroplast-derived nanoscale thylakoid supercomplex system, enables mammalian corneal cells to generate photosynthetic NADPH and ATP that suppress oxidative stress and inflammation.. LEAF functions intracellularly and extracellularly to restore redox balance, establishing a light-driven therapeutic strategy with a cross-kingdom, prolonged endosymbiosis-like interaction.

Article Title: Method of identifying pro-inflammatory dendritic cells
Article Snippet: .. GEO: GSE40484 Segura et al. https//doi:10.1084/jem.20121103 Software and Algorithms DIVA BD Biosciences https://www.bdbiosciences.com/en-us FlowJo v.10.5.3 Tree Star Inc. https://www.flowjo.com SeqGeq FlowJo, LLC https://www.flowjo.com/solutions/seqgeq GraphPad Prism 6 Graphpad https://www.graphpad.com/scientific-software/prism/ R 4.4 The R Foundation https://www.r-project.org tSNE Van Der Maaten et al., 2008, https://github.com/jkrijthe/Rtsne Journal of Machine Learning Research. https://doi.org/10.1007/s10479-011-0841-3 UMAP McInnes et al., 2018, arXiv: 1802.03426 https://github.com/lmcinnes/umap SVM regression used in The R Foundation https://cran.r-project.org/web/packages/e1071 InfinityFlow Seurat V2 Butler et al., 2018, Nature Biotech. https://doi.org/10.1038/nbt.4096 https://satijalab.org/seurat/ Phenograph Levine et al., 2015, Cell. https://github.com/JinmiaoChenLab/Rphenograph doi:10.1016/j.cell.2015.05.047 NBOR J. Chen et al., 2016, Nat. https://github.com/JinmiaoChenLab/Mpath Commun. ..

Article Title: SEPHS2 loss reprograms cancer metabolism from oxidative phosphorylation to gluconeogenesis via PCK1 stabilization.
Article Snippet: Upon arrival at the animal core facility of Southern University of Science and Technology, mice were acclimated for 1 week in a barrier facility to minimize the potential effects of .. REAGENT or RESOURCE SOURCE IDENTIFIER M&R HRP/DAB Detection IHC Kit Vazyme Cat#HC301-01; Lot#7E2762K4 Deposited data Transcriptomics: A-375 control and SEPHS2 knockout cells This paper GSE:324223 Proteomics:A-375 control and SEPHS2 knockout cells This paper PXD076137 Experimental models: Cell lines A-375 ATCC Cat#CRL-1619 HeLa ATCC Cat#CCL-2 A2058 CellCook Cat#CC1805 HEK-293FT CellCook Cat#CC4046 MCF-7 CellCook Cat#CC0302 Experimental models: Organisms/strains BALB/c nude mice Charles River Laboratories Cat#401 NCG[(Prkdc)KO/KO∼(Il2rg)KO/KO] mice GemPharmatech Cat#T001475 Oligonucleotides See Table S1 for the shRNA and sgRNA for gene deficiency This paper N/A See Table S2 for the primers used for real-time qPCR This paper N/A Recombinant DNA pLKO.1-TCR Addgene Cat#10878 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 LentiCRISPR v2 Addgene Cat#52961 pCMV-HA-UB-Neo MiaoLing bio Cat#P51735 pCMV-PCK1(human)-3×Flag-Neo MiaoLing bio Cat#P49543 Software and algorithms Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ FIJI (ImageJ) NIH https://imagej.net/software/fiji/ FlowJo Software 10.10 TreeStar Inc https://www.flowjo.com/ BioRender.com BioRender https://www.biorender.com/ QuantStudioTM Design & Analysis Software real-time PCR https://www.thermofisher.cn/cn/zh/home/ technical-resources/software-downloads/ quantstudio-3-5-real-time-pcr-systems.html SnapGene 4.3.6 SnapGene https://www.snapgene.com/ TBtools-II Chen et al. https://apps.microsoft.com/detail/ 9nvr9lb426p2?hl=zh-cn&gl=CN R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ Wave Seahorse https://www.agilent.com.cn/zh-cn/product/cell- analysis/real-time-cell-metabolic-analysis/xfsoftware/software-download-for-seahorse-wavepro-software Cell Reports 45, 117297, May 26, 2026 17 transportation stress on experimental outcomes. ..

Article Title: Natural killer cells swarm and cross-recruit cytotoxic T cells via CCR5.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays NK Cell Isolation Kit, mouse Miltenyi Biotec Cat. #. .. 130-115-818 EasySep Human CD3 Positive Selection Kit II StemCell Technologie Cat. #: 17851 LEGENDplex Multi-Analyte Flow Assay Kit Biolegend Cat. #: 740451 LegendPlex Human Proinflammatory Chemokine panel Biolegend Cat. #: 741081 LegendPlex Human CD8/NK panel BioLegend Cat. #: 741187 RNeasy Mini Kit Qiagen Cat. #: 17854 Experimental models: Cell lines Murine EL4 lymphoma ATCC Cat. #: TIB-39TM Murine EL4-Rae1β This paper N/A Murine EL4-Rae1β-OVA This paper N/A Murine YAC-1 lymphoblast Gift from N. Huntington (Monash University) N/A NK-92 human NK cell line ATCC Cat. #: CRL2407 K562 human leukemic cell line ATCC Cat. #: CCL-243 Experimental models: Organisms/strains Mouse: C57BL/6J Gift from E. Deenick (Garvan Institute of Medical Research) N/A Mouse: C57BL/6 OT-I x Lifeact-EGFP Galeano Niño et al.19,27 N/A Mouse: C57BL/6 OT-I x TdTomato Galeano Niño et al.19,27; Muzumdar et al.45 N/A Mouse: NOD.CgPrkdcIL2rg/SzJAusb (NSG) Jackson Laboratory Strain #:005557; RRID:IMSR_JAX:005557 Oligonucleotides RT-qPCR primers used in this study are listed in Table S3 Bio-Rad Laboratories N/A Recombinant DNA Rae1β-mTagBFP and mTagBFP2-OVAAg85b gBlocks Integrated DNA Technologies Inc N/A Software and algorithms BD FACSDiva version 7 BD Biosciences N/A FlowJo version 10.2 Treestar Inc N/A Prism 9.5.1 GraphPad Software N/A Imaris version 9.2.1 Bitplane AG N/A MATLAB version 2018b Mathworks Inc N/A Algorithms to generate ‘M’ metric Galeano Niño et al.19,27; Hywood et al.25 N/A Biostitch Vaskivskyi et al.46 N/A Cellpose (Stringer et al.47) N/A Qupath 0.5.1 (Bankhead et al.48) N/A Other AccuCount Blank Particles Spherotech Cat. #: ACBP-70-10 Sensoplate Microplate, 96 well, PS, F-bottom Greiner Cat. #: 655892 35 mm Dish | No. 1.5 Coverslip | 14 mm Glass Diameter | Uncoated Mattek Cat. #: P35G-1.5-14-C Transwell inserts: 5 μm pore size polycarvbonate 6.5mm diameter membrane inserts Costar Cat. #: 3421 Cyto-Fast Fix/Perm Buffer Set BioLegend Cat. #: 426803 (Continued on next page) 14 Cell Reports 45, 117415, June 23, 2026 ..

Microscopy:

Article Title: 5' UTR introns reduce nuclear transgene silencing and enable robust protein expression in Chlamydomonas reinhardtii.
Article Snippet: .. This paper N/A Software and algorithms GraphPad Prism version 9.5.1 GraphPad https://www.graphpad.com/ R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/downloads QuantStudioTM Design & Analysis Software Thermo Fisher https://www.thermofisher.cn/cn/zh/home/technical- resources/software-downloads/quantstudio-3-5real-time-pcr-systems.html Fiji Schindelin et al.34 https://imagej.net/software/fiji/downloads Other LSM 980 Confocal Microscope Zeiss LSM 980 BD LSR II flow cytometer BD biosciences N/A SapphireTM Biomolecular Imager Azure Biosystems N/A Cell Reports 45, 117424, June 23, 2026 13 ..

Flow Cytometry:

Article Title: 5' UTR introns reduce nuclear transgene silencing and enable robust protein expression in Chlamydomonas reinhardtii.
Article Snippet: .. This paper N/A Software and algorithms GraphPad Prism version 9.5.1 GraphPad https://www.graphpad.com/ R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ FlowJo v10 TreeStar https://www.flowjo.com/solutions/flowjo/downloads QuantStudioTM Design & Analysis Software Thermo Fisher https://www.thermofisher.cn/cn/zh/home/technical- resources/software-downloads/quantstudio-3-5real-time-pcr-systems.html Fiji Schindelin et al.34 https://imagej.net/software/fiji/downloads Other LSM 980 Confocal Microscope Zeiss LSM 980 BD LSR II flow cytometer BD biosciences N/A SapphireTM Biomolecular Imager Azure Biosystems N/A Cell Reports 45, 117424, June 23, 2026 13 ..

Article Title: Transplanting light-dependent reactions for mammalian eye photosynthesis.
Article Snippet: In brief Therapeutic delivery of LEAF, a chloroplast-derived nanoscale thylakoid supercomplex system, enables mammalian corneal cells to generate photosynthetic NADPH and ATP that suppress oxidative stress and inflammation.. LEAF functions intracellularly and extracellularly to restore redox balance, establishing a light-driven therapeutic strategy with a cross-kingdom, prolonged endosymbiosis-like interaction.

other:

Article Title: Glehnia littoralis and imperatorin attenuate allergic airway inflammation via mast cell stabilization and transcriptome-defined suppression of FcεRI/TLR-MAPK/NF-κB signaling.
Article Snippet: 20 Background: Allergic airway inflammation is driven by mast cell activation and IgE–FcεRI 21 signaling.. Current pharmacological treatments often present limited efficacy or long-term 22 adverse effects.. Glehnia littoralis Fr.

Article Title: Characterization of a transmembrane-activating STING agonist using genetically humanized mice.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HEK293T stably expressing mCherry-GFP-LC3 This paper N/A DC2.4 stably expressing OVA This paper N/A THF ATG5 knockout cells This paper N/A B16F10 (tumor cell line) ATCC CRL-6475 (authenticated by the OHSU Integrated Genomics Core facility); RRID: CVCL_0159 MC38 (tumor cell line) Millipore SCC172 (authenticated by the OHSU Integrated Genomics Core facility); RRID: CVCL_B288 Experimental models: Organisms/strains Mouse: C57BL/6 The Jackson Laboratory 000664; RRID: IMSR_JAX:000664 Mouse: humanized STING (huSTING) This paper; Cyagen Biosciences N/A Mouse: C57BL/6GT (STING golden ticket) The Jackson Laboratory 017537; RRID: IMSR_JAX:017537 Oligonucleotides ATG5 gRNA: GATGGACAGTTGCA CACACT This paper N/A Genotyping primer F3: CATAGAAAAG CCTTGACTTGAGGTT This paper N/A Genotyping primer R1: AGCCCTTGTAATG AAAACAGAGGT This paper N/A Genotyping primer F1: CATAGAAAAGCC TTGACTTGAGGTT This paper N/A Genotyping primer F2: ACACGCTCTGT TTACTATGAACCT This paper N/A Genotyping primer R2: CCCGTTTAACA GCAGTCCCA This paper N/A PrimeTime qPCR primer/probe sets (multiple genes) Integrated DNA Technologies (IDT) N/A Recombinant DNA pLVX-EF1a-Puro vector Takara Bio 631988 LentiCRISPRv2 Addgene 98290: RRID: Addgene_98290 pMD2.g Addgene 12259; RRID: Addgene_12259 psPAX2 Addgene 12260; RRID: Addgene_12260 pRSET-B Invitrogen V35120 IFIT1-Luc (luciferase reporter plasmid) Sali et al.52 N/A pLVX encoding human STING WT This paper; Twist Biosciences N/A pLVX encoding human STING HAQ This paper; Twist Biosciences N/A pLVX encoding human STING R232H This paper; Twist Biosciences N/A pLVX encoding STING-P2A-BFP fusion This paper; Twist Biosciences N/A pLVX encoding mCherry-GFP-LC3 This paper; Twist Biosciences N/A pLVX encoding OVA This paper; Twist Biosciences N/A pRSET-B encoding 6xHIS-STING (aa 137- 379) This paper; Twist Biosciences N/A Software and algorithms FlowJo v10.10.0 Tree Star https://www.flowjo.com; RRID: SCR_008520 FlowJo v10.7.1 Tree Star https://www.flowjo.com; RRID: SCR_008520 GraphPad Prism GraphPad Software https://www.graphpad.com; RRID: SCR_002798 (Continued on next page) 20 Cell Reports 45, 117475, June 23, 2026

Article Title: STING-OPTN signaling confers cytoprotection through TBK1-dependent mitophagy.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER YPH mito-keima Dr. Richard J. Youle N/A HEK293T stably expressing YFP-Parkin Dr. Han-Ming Shen N/A SH-SY5Y ATCC Cat#CRL-2266; RRID:CVCL_0019 Oligonucleotides siRNA targeting cGAS Purchased from Integrated DNA Technologies (IDT) Design ID: hs.Ri.MB21D1.13 siRNA targeting TBK1 Purchased from Integrated DNA Technologies (IDT) Design ID: hs.Ri.TBK1.13 siRNA targeting STING #1: AGCATTACAACAACCTGCT Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting STING #2: CGAACTTACAATCAGCATT Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting OPTN: CCACCAGCTGAAAGAAGCC Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting PINK1 Purchased from Invitrogen Cat#1299001 siRNA targeting sequence: VCP #1: CAGUGUUGCUGAAAGGAAAGA UUUCCUUUCAGCAACACUGUG Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting sequence: VCP #2: GCAGCUAGCUCAGAUCAAAGA UUUGAUCUGAGCUAGCUGCUU Synthesized by Tsingke Biotechnology (Beijing, China) N/A siRNA targeting sequence: VCP #3: GCAAGAAGAUGGAUCUCAUUG AUGAGAUCCAUCUUCUUGCGG Synthesized by Tsingke Biotechnology (Beijing, China) N/A Recombinant DNA lentiCRISPR v2 Dr. Feng Zhang Addgene plasmid # 52961; RRID:Addgene_52961 Lentiguide V2-sgcGAS Dr. James Chen N/A Lentiguide V2-sgSTING Dr. James Chen N/A Lentiguide V2-sgTBK1 Dr. James Chen N/A pCDNA4-TREX1-WT-3XFLAG This paper N/A pCDNA4-PINK1-WT-3XFLAG This paper N/A pCDNA4-PINK1-E240K-3XFLAG This paper N/A pCDNA4-PINK1-G309D-3XFLAG This paper N/A Parkin-WT-FLAG Dr. Liming Wang N/A Parkin-S65A-FLAG Dr. Liming Wang N/A OPTN-FLAG Dr. Qiming Sun N/A TBK1-FLAG Dr. Wei Wan N/A Software and algorithms GraphPad Prism (https://www.graphpad. com/features) GraphPad Software Version 8.0 FlowJo (https://www.flowjo.com/) Tree Star Software Version 10.0 Adobe Illustrator (http://www.adobe.com/ cn/) Adobe Systems Version 26.0 ImageJ (https://imagej.nih.gov/ij/) Java Version 1.8.0 Other 1 × PBS BioChannel Biological Technology Co., Ltd. Cat#BC-BPBS-01 not-fat milk Biosharp Cat#BS102-500g Protease Inhibitor Cocktail TargetMol Cat#C0001-1 mL Phosphatase Inhibitor Cocktail III TargetMol Cat#C0004-2 mL Stripping Buffer CWBIO Cat#CW0056 Cell Reports 45, 117515, June 23, 2026 19

Enzyme-linked Immunosorbent Assay:

Article Title: Transplanting light-dependent reactions for mammalian eye photosynthesis.
Article Snippet: In brief Therapeutic delivery of LEAF, a chloroplast-derived nanoscale thylakoid supercomplex system, enables mammalian corneal cells to generate photosynthetic NADPH and ATP that suppress oxidative stress and inflammation.. LEAF functions intracellularly and extracellularly to restore redox balance, establishing a light-driven therapeutic strategy with a cross-kingdom, prolonged endosymbiosis-like interaction.

Real-time Polymerase Chain Reaction:

Article Title: Transplanting light-dependent reactions for mammalian eye photosynthesis.
Article Snippet: In brief Therapeutic delivery of LEAF, a chloroplast-derived nanoscale thylakoid supercomplex system, enables mammalian corneal cells to generate photosynthetic NADPH and ATP that suppress oxidative stress and inflammation.. LEAF functions intracellularly and extracellularly to restore redox balance, establishing a light-driven therapeutic strategy with a cross-kingdom, prolonged endosymbiosis-like interaction.

Article Title: SEPHS2 loss reprograms cancer metabolism from oxidative phosphorylation to gluconeogenesis via PCK1 stabilization.
Article Snippet: Upon arrival at the animal core facility of Southern University of Science and Technology, mice were acclimated for 1 week in a barrier facility to minimize the potential effects of .. REAGENT or RESOURCE SOURCE IDENTIFIER M&R HRP/DAB Detection IHC Kit Vazyme Cat#HC301-01; Lot#7E2762K4 Deposited data Transcriptomics: A-375 control and SEPHS2 knockout cells This paper GSE:324223 Proteomics:A-375 control and SEPHS2 knockout cells This paper PXD076137 Experimental models: Cell lines A-375 ATCC Cat#CRL-1619 HeLa ATCC Cat#CCL-2 A2058 CellCook Cat#CC1805 HEK-293FT CellCook Cat#CC4046 MCF-7 CellCook Cat#CC0302 Experimental models: Organisms/strains BALB/c nude mice Charles River Laboratories Cat#401 NCG[(Prkdc)KO/KO∼(Il2rg)KO/KO] mice GemPharmatech Cat#T001475 Oligonucleotides See Table S1 for the shRNA and sgRNA for gene deficiency This paper N/A See Table S2 for the primers used for real-time qPCR This paper N/A Recombinant DNA pLKO.1-TCR Addgene Cat#10878 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 LentiCRISPR v2 Addgene Cat#52961 pCMV-HA-UB-Neo MiaoLing bio Cat#P51735 pCMV-PCK1(human)-3×Flag-Neo MiaoLing bio Cat#P49543 Software and algorithms Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ FIJI (ImageJ) NIH https://imagej.net/software/fiji/ FlowJo Software 10.10 TreeStar Inc https://www.flowjo.com/ BioRender.com BioRender https://www.biorender.com/ QuantStudioTM Design & Analysis Software real-time PCR https://www.thermofisher.cn/cn/zh/home/ technical-resources/software-downloads/ quantstudio-3-5-real-time-pcr-systems.html SnapGene 4.3.6 SnapGene https://www.snapgene.com/ TBtools-II Chen et al. https://apps.microsoft.com/detail/ 9nvr9lb426p2?hl=zh-cn&gl=CN R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ Wave Seahorse https://www.agilent.com.cn/zh-cn/product/cell- analysis/real-time-cell-metabolic-analysis/xfsoftware/software-download-for-seahorse-wavepro-software Cell Reports 45, 117297, May 26, 2026 17 transportation stress on experimental outcomes. ..

Data-independent acquisition:

Article Title: Transplanting light-dependent reactions for mammalian eye photosynthesis.
Article Snippet: In brief Therapeutic delivery of LEAF, a chloroplast-derived nanoscale thylakoid supercomplex system, enables mammalian corneal cells to generate photosynthetic NADPH and ATP that suppress oxidative stress and inflammation.. LEAF functions intracellularly and extracellularly to restore redox balance, establishing a light-driven therapeutic strategy with a cross-kingdom, prolonged endosymbiosis-like interaction.

Imaging:

Article Title: Transplanting light-dependent reactions for mammalian eye photosynthesis.
Article Snippet: In brief Therapeutic delivery of LEAF, a chloroplast-derived nanoscale thylakoid supercomplex system, enables mammalian corneal cells to generate photosynthetic NADPH and ATP that suppress oxidative stress and inflammation.. LEAF functions intracellularly and extracellularly to restore redox balance, establishing a light-driven therapeutic strategy with a cross-kingdom, prolonged endosymbiosis-like interaction.

Light Microscopy:

Article Title: Transplanting light-dependent reactions for mammalian eye photosynthesis.
Article Snippet: In brief Therapeutic delivery of LEAF, a chloroplast-derived nanoscale thylakoid supercomplex system, enables mammalian corneal cells to generate photosynthetic NADPH and ATP that suppress oxidative stress and inflammation.. LEAF functions intracellularly and extracellularly to restore redox balance, establishing a light-driven therapeutic strategy with a cross-kingdom, prolonged endosymbiosis-like interaction.

Laser-Scanning Microscopy:

Article Title: Transplanting light-dependent reactions for mammalian eye photosynthesis.
Article Snippet: In brief Therapeutic delivery of LEAF, a chloroplast-derived nanoscale thylakoid supercomplex system, enables mammalian corneal cells to generate photosynthetic NADPH and ATP that suppress oxidative stress and inflammation.. LEAF functions intracellularly and extracellularly to restore redox balance, establishing a light-driven therapeutic strategy with a cross-kingdom, prolonged endosymbiosis-like interaction.

Immunohistochemistry:

Article Title: SEPHS2 loss reprograms cancer metabolism from oxidative phosphorylation to gluconeogenesis via PCK1 stabilization.
Article Snippet: Upon arrival at the animal core facility of Southern University of Science and Technology, mice were acclimated for 1 week in a barrier facility to minimize the potential effects of .. REAGENT or RESOURCE SOURCE IDENTIFIER M&R HRP/DAB Detection IHC Kit Vazyme Cat#HC301-01; Lot#7E2762K4 Deposited data Transcriptomics: A-375 control and SEPHS2 knockout cells This paper GSE:324223 Proteomics:A-375 control and SEPHS2 knockout cells This paper PXD076137 Experimental models: Cell lines A-375 ATCC Cat#CRL-1619 HeLa ATCC Cat#CCL-2 A2058 CellCook Cat#CC1805 HEK-293FT CellCook Cat#CC4046 MCF-7 CellCook Cat#CC0302 Experimental models: Organisms/strains BALB/c nude mice Charles River Laboratories Cat#401 NCG[(Prkdc)KO/KO∼(Il2rg)KO/KO] mice GemPharmatech Cat#T001475 Oligonucleotides See Table S1 for the shRNA and sgRNA for gene deficiency This paper N/A See Table S2 for the primers used for real-time qPCR This paper N/A Recombinant DNA pLKO.1-TCR Addgene Cat#10878 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 LentiCRISPR v2 Addgene Cat#52961 pCMV-HA-UB-Neo MiaoLing bio Cat#P51735 pCMV-PCK1(human)-3×Flag-Neo MiaoLing bio Cat#P49543 Software and algorithms Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ FIJI (ImageJ) NIH https://imagej.net/software/fiji/ FlowJo Software 10.10 TreeStar Inc https://www.flowjo.com/ BioRender.com BioRender https://www.biorender.com/ QuantStudioTM Design & Analysis Software real-time PCR https://www.thermofisher.cn/cn/zh/home/ technical-resources/software-downloads/ quantstudio-3-5-real-time-pcr-systems.html SnapGene 4.3.6 SnapGene https://www.snapgene.com/ TBtools-II Chen et al. https://apps.microsoft.com/detail/ 9nvr9lb426p2?hl=zh-cn&gl=CN R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ Wave Seahorse https://www.agilent.com.cn/zh-cn/product/cell- analysis/real-time-cell-metabolic-analysis/xfsoftware/software-download-for-seahorse-wavepro-software Cell Reports 45, 117297, May 26, 2026 17 transportation stress on experimental outcomes. ..

Transcriptomics:

Article Title: SEPHS2 loss reprograms cancer metabolism from oxidative phosphorylation to gluconeogenesis via PCK1 stabilization.
Article Snippet: Upon arrival at the animal core facility of Southern University of Science and Technology, mice were acclimated for 1 week in a barrier facility to minimize the potential effects of .. REAGENT or RESOURCE SOURCE IDENTIFIER M&R HRP/DAB Detection IHC Kit Vazyme Cat#HC301-01; Lot#7E2762K4 Deposited data Transcriptomics: A-375 control and SEPHS2 knockout cells This paper GSE:324223 Proteomics:A-375 control and SEPHS2 knockout cells This paper PXD076137 Experimental models: Cell lines A-375 ATCC Cat#CRL-1619 HeLa ATCC Cat#CCL-2 A2058 CellCook Cat#CC1805 HEK-293FT CellCook Cat#CC4046 MCF-7 CellCook Cat#CC0302 Experimental models: Organisms/strains BALB/c nude mice Charles River Laboratories Cat#401 NCG[(Prkdc)KO/KO∼(Il2rg)KO/KO] mice GemPharmatech Cat#T001475 Oligonucleotides See Table S1 for the shRNA and sgRNA for gene deficiency This paper N/A See Table S2 for the primers used for real-time qPCR This paper N/A Recombinant DNA pLKO.1-TCR Addgene Cat#10878 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 LentiCRISPR v2 Addgene Cat#52961 pCMV-HA-UB-Neo MiaoLing bio Cat#P51735 pCMV-PCK1(human)-3×Flag-Neo MiaoLing bio Cat#P49543 Software and algorithms Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ FIJI (ImageJ) NIH https://imagej.net/software/fiji/ FlowJo Software 10.10 TreeStar Inc https://www.flowjo.com/ BioRender.com BioRender https://www.biorender.com/ QuantStudioTM Design & Analysis Software real-time PCR https://www.thermofisher.cn/cn/zh/home/ technical-resources/software-downloads/ quantstudio-3-5-real-time-pcr-systems.html SnapGene 4.3.6 SnapGene https://www.snapgene.com/ TBtools-II Chen et al. https://apps.microsoft.com/detail/ 9nvr9lb426p2?hl=zh-cn&gl=CN R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ Wave Seahorse https://www.agilent.com.cn/zh-cn/product/cell- analysis/real-time-cell-metabolic-analysis/xfsoftware/software-download-for-seahorse-wavepro-software Cell Reports 45, 117297, May 26, 2026 17 transportation stress on experimental outcomes. ..

Control:

Article Title: SEPHS2 loss reprograms cancer metabolism from oxidative phosphorylation to gluconeogenesis via PCK1 stabilization.
Article Snippet: Upon arrival at the animal core facility of Southern University of Science and Technology, mice were acclimated for 1 week in a barrier facility to minimize the potential effects of .. REAGENT or RESOURCE SOURCE IDENTIFIER M&R HRP/DAB Detection IHC Kit Vazyme Cat#HC301-01; Lot#7E2762K4 Deposited data Transcriptomics: A-375 control and SEPHS2 knockout cells This paper GSE:324223 Proteomics:A-375 control and SEPHS2 knockout cells This paper PXD076137 Experimental models: Cell lines A-375 ATCC Cat#CRL-1619 HeLa ATCC Cat#CCL-2 A2058 CellCook Cat#CC1805 HEK-293FT CellCook Cat#CC4046 MCF-7 CellCook Cat#CC0302 Experimental models: Organisms/strains BALB/c nude mice Charles River Laboratories Cat#401 NCG[(Prkdc)KO/KO∼(Il2rg)KO/KO] mice GemPharmatech Cat#T001475 Oligonucleotides See Table S1 for the shRNA and sgRNA for gene deficiency This paper N/A See Table S2 for the primers used for real-time qPCR This paper N/A Recombinant DNA pLKO.1-TCR Addgene Cat#10878 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 LentiCRISPR v2 Addgene Cat#52961 pCMV-HA-UB-Neo MiaoLing bio Cat#P51735 pCMV-PCK1(human)-3×Flag-Neo MiaoLing bio Cat#P49543 Software and algorithms Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ FIJI (ImageJ) NIH https://imagej.net/software/fiji/ FlowJo Software 10.10 TreeStar Inc https://www.flowjo.com/ BioRender.com BioRender https://www.biorender.com/ QuantStudioTM Design & Analysis Software real-time PCR https://www.thermofisher.cn/cn/zh/home/ technical-resources/software-downloads/ quantstudio-3-5-real-time-pcr-systems.html SnapGene 4.3.6 SnapGene https://www.snapgene.com/ TBtools-II Chen et al. https://apps.microsoft.com/detail/ 9nvr9lb426p2?hl=zh-cn&gl=CN R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ Wave Seahorse https://www.agilent.com.cn/zh-cn/product/cell- analysis/real-time-cell-metabolic-analysis/xfsoftware/software-download-for-seahorse-wavepro-software Cell Reports 45, 117297, May 26, 2026 17 transportation stress on experimental outcomes. ..

Knock-Out:

Article Title: SEPHS2 loss reprograms cancer metabolism from oxidative phosphorylation to gluconeogenesis via PCK1 stabilization.
Article Snippet: Upon arrival at the animal core facility of Southern University of Science and Technology, mice were acclimated for 1 week in a barrier facility to minimize the potential effects of .. REAGENT or RESOURCE SOURCE IDENTIFIER M&R HRP/DAB Detection IHC Kit Vazyme Cat#HC301-01; Lot#7E2762K4 Deposited data Transcriptomics: A-375 control and SEPHS2 knockout cells This paper GSE:324223 Proteomics:A-375 control and SEPHS2 knockout cells This paper PXD076137 Experimental models: Cell lines A-375 ATCC Cat#CRL-1619 HeLa ATCC Cat#CCL-2 A2058 CellCook Cat#CC1805 HEK-293FT CellCook Cat#CC4046 MCF-7 CellCook Cat#CC0302 Experimental models: Organisms/strains BALB/c nude mice Charles River Laboratories Cat#401 NCG[(Prkdc)KO/KO∼(Il2rg)KO/KO] mice GemPharmatech Cat#T001475 Oligonucleotides See Table S1 for the shRNA and sgRNA for gene deficiency This paper N/A See Table S2 for the primers used for real-time qPCR This paper N/A Recombinant DNA pLKO.1-TCR Addgene Cat#10878 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 LentiCRISPR v2 Addgene Cat#52961 pCMV-HA-UB-Neo MiaoLing bio Cat#P51735 pCMV-PCK1(human)-3×Flag-Neo MiaoLing bio Cat#P49543 Software and algorithms Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ FIJI (ImageJ) NIH https://imagej.net/software/fiji/ FlowJo Software 10.10 TreeStar Inc https://www.flowjo.com/ BioRender.com BioRender https://www.biorender.com/ QuantStudioTM Design & Analysis Software real-time PCR https://www.thermofisher.cn/cn/zh/home/ technical-resources/software-downloads/ quantstudio-3-5-real-time-pcr-systems.html SnapGene 4.3.6 SnapGene https://www.snapgene.com/ TBtools-II Chen et al. https://apps.microsoft.com/detail/ 9nvr9lb426p2?hl=zh-cn&gl=CN R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ Wave Seahorse https://www.agilent.com.cn/zh-cn/product/cell- analysis/real-time-cell-metabolic-analysis/xfsoftware/software-download-for-seahorse-wavepro-software Cell Reports 45, 117297, May 26, 2026 17 transportation stress on experimental outcomes. ..

shRNA:

Article Title: SEPHS2 loss reprograms cancer metabolism from oxidative phosphorylation to gluconeogenesis via PCK1 stabilization.
Article Snippet: Upon arrival at the animal core facility of Southern University of Science and Technology, mice were acclimated for 1 week in a barrier facility to minimize the potential effects of .. REAGENT or RESOURCE SOURCE IDENTIFIER M&R HRP/DAB Detection IHC Kit Vazyme Cat#HC301-01; Lot#7E2762K4 Deposited data Transcriptomics: A-375 control and SEPHS2 knockout cells This paper GSE:324223 Proteomics:A-375 control and SEPHS2 knockout cells This paper PXD076137 Experimental models: Cell lines A-375 ATCC Cat#CRL-1619 HeLa ATCC Cat#CCL-2 A2058 CellCook Cat#CC1805 HEK-293FT CellCook Cat#CC4046 MCF-7 CellCook Cat#CC0302 Experimental models: Organisms/strains BALB/c nude mice Charles River Laboratories Cat#401 NCG[(Prkdc)KO/KO∼(Il2rg)KO/KO] mice GemPharmatech Cat#T001475 Oligonucleotides See Table S1 for the shRNA and sgRNA for gene deficiency This paper N/A See Table S2 for the primers used for real-time qPCR This paper N/A Recombinant DNA pLKO.1-TCR Addgene Cat#10878 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 LentiCRISPR v2 Addgene Cat#52961 pCMV-HA-UB-Neo MiaoLing bio Cat#P51735 pCMV-PCK1(human)-3×Flag-Neo MiaoLing bio Cat#P49543 Software and algorithms Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ FIJI (ImageJ) NIH https://imagej.net/software/fiji/ FlowJo Software 10.10 TreeStar Inc https://www.flowjo.com/ BioRender.com BioRender https://www.biorender.com/ QuantStudioTM Design & Analysis Software real-time PCR https://www.thermofisher.cn/cn/zh/home/ technical-resources/software-downloads/ quantstudio-3-5-real-time-pcr-systems.html SnapGene 4.3.6 SnapGene https://www.snapgene.com/ TBtools-II Chen et al. https://apps.microsoft.com/detail/ 9nvr9lb426p2?hl=zh-cn&gl=CN R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ Wave Seahorse https://www.agilent.com.cn/zh-cn/product/cell- analysis/real-time-cell-metabolic-analysis/xfsoftware/software-download-for-seahorse-wavepro-software Cell Reports 45, 117297, May 26, 2026 17 transportation stress on experimental outcomes. ..

Recombinant:

Article Title: SEPHS2 loss reprograms cancer metabolism from oxidative phosphorylation to gluconeogenesis via PCK1 stabilization.
Article Snippet: Upon arrival at the animal core facility of Southern University of Science and Technology, mice were acclimated for 1 week in a barrier facility to minimize the potential effects of .. REAGENT or RESOURCE SOURCE IDENTIFIER M&R HRP/DAB Detection IHC Kit Vazyme Cat#HC301-01; Lot#7E2762K4 Deposited data Transcriptomics: A-375 control and SEPHS2 knockout cells This paper GSE:324223 Proteomics:A-375 control and SEPHS2 knockout cells This paper PXD076137 Experimental models: Cell lines A-375 ATCC Cat#CRL-1619 HeLa ATCC Cat#CCL-2 A2058 CellCook Cat#CC1805 HEK-293FT CellCook Cat#CC4046 MCF-7 CellCook Cat#CC0302 Experimental models: Organisms/strains BALB/c nude mice Charles River Laboratories Cat#401 NCG[(Prkdc)KO/KO∼(Il2rg)KO/KO] mice GemPharmatech Cat#T001475 Oligonucleotides See Table S1 for the shRNA and sgRNA for gene deficiency This paper N/A See Table S2 for the primers used for real-time qPCR This paper N/A Recombinant DNA pLKO.1-TCR Addgene Cat#10878 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 LentiCRISPR v2 Addgene Cat#52961 pCMV-HA-UB-Neo MiaoLing bio Cat#P51735 pCMV-PCK1(human)-3×Flag-Neo MiaoLing bio Cat#P49543 Software and algorithms Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ FIJI (ImageJ) NIH https://imagej.net/software/fiji/ FlowJo Software 10.10 TreeStar Inc https://www.flowjo.com/ BioRender.com BioRender https://www.biorender.com/ QuantStudioTM Design & Analysis Software real-time PCR https://www.thermofisher.cn/cn/zh/home/ technical-resources/software-downloads/ quantstudio-3-5-real-time-pcr-systems.html SnapGene 4.3.6 SnapGene https://www.snapgene.com/ TBtools-II Chen et al. https://apps.microsoft.com/detail/ 9nvr9lb426p2?hl=zh-cn&gl=CN R version 4.2.2 R https://cran.r-project.org/bin/windows/base/ Wave Seahorse https://www.agilent.com.cn/zh-cn/product/cell- analysis/real-time-cell-metabolic-analysis/xfsoftware/software-download-for-seahorse-wavepro-software Cell Reports 45, 117297, May 26, 2026 17 transportation stress on experimental outcomes. ..

Article Title: Natural killer cells swarm and cross-recruit cytotoxic T cells via CCR5.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays NK Cell Isolation Kit, mouse Miltenyi Biotec Cat. #. .. 130-115-818 EasySep Human CD3 Positive Selection Kit II StemCell Technologie Cat. #: 17851 LEGENDplex Multi-Analyte Flow Assay Kit Biolegend Cat. #: 740451 LegendPlex Human Proinflammatory Chemokine panel Biolegend Cat. #: 741081 LegendPlex Human CD8/NK panel BioLegend Cat. #: 741187 RNeasy Mini Kit Qiagen Cat. #: 17854 Experimental models: Cell lines Murine EL4 lymphoma ATCC Cat. #: TIB-39TM Murine EL4-Rae1β This paper N/A Murine EL4-Rae1β-OVA This paper N/A Murine YAC-1 lymphoblast Gift from N. Huntington (Monash University) N/A NK-92 human NK cell line ATCC Cat. #: CRL2407 K562 human leukemic cell line ATCC Cat. #: CCL-243 Experimental models: Organisms/strains Mouse: C57BL/6J Gift from E. Deenick (Garvan Institute of Medical Research) N/A Mouse: C57BL/6 OT-I x Lifeact-EGFP Galeano Niño et al.19,27 N/A Mouse: C57BL/6 OT-I x TdTomato Galeano Niño et al.19,27; Muzumdar et al.45 N/A Mouse: NOD.CgPrkdcIL2rg/SzJAusb (NSG) Jackson Laboratory Strain #:005557; RRID:IMSR_JAX:005557 Oligonucleotides RT-qPCR primers used in this study are listed in Table S3 Bio-Rad Laboratories N/A Recombinant DNA Rae1β-mTagBFP and mTagBFP2-OVAAg85b gBlocks Integrated DNA Technologies Inc N/A Software and algorithms BD FACSDiva version 7 BD Biosciences N/A FlowJo version 10.2 Treestar Inc N/A Prism 9.5.1 GraphPad Software N/A Imaris version 9.2.1 Bitplane AG N/A MATLAB version 2018b Mathworks Inc N/A Algorithms to generate ‘M’ metric Galeano Niño et al.19,27; Hywood et al.25 N/A Biostitch Vaskivskyi et al.46 N/A Cellpose (Stringer et al.47) N/A Qupath 0.5.1 (Bankhead et al.48) N/A Other AccuCount Blank Particles Spherotech Cat. #: ACBP-70-10 Sensoplate Microplate, 96 well, PS, F-bottom Greiner Cat. #: 655892 35 mm Dish | No. 1.5 Coverslip | 14 mm Glass Diameter | Uncoated Mattek Cat. #: P35G-1.5-14-C Transwell inserts: 5 μm pore size polycarvbonate 6.5mm diameter membrane inserts Costar Cat. #: 3421 Cyto-Fast Fix/Perm Buffer Set BioLegend Cat. #: 426803 (Continued on next page) 14 Cell Reports 45, 117415, June 23, 2026 ..

Selection:

Article Title: Natural killer cells swarm and cross-recruit cytotoxic T cells via CCR5.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays NK Cell Isolation Kit, mouse Miltenyi Biotec Cat. #. .. 130-115-818 EasySep Human CD3 Positive Selection Kit II StemCell Technologie Cat. #: 17851 LEGENDplex Multi-Analyte Flow Assay Kit Biolegend Cat. #: 740451 LegendPlex Human Proinflammatory Chemokine panel Biolegend Cat. #: 741081 LegendPlex Human CD8/NK panel BioLegend Cat. #: 741187 RNeasy Mini Kit Qiagen Cat. #: 17854 Experimental models: Cell lines Murine EL4 lymphoma ATCC Cat. #: TIB-39TM Murine EL4-Rae1β This paper N/A Murine EL4-Rae1β-OVA This paper N/A Murine YAC-1 lymphoblast Gift from N. Huntington (Monash University) N/A NK-92 human NK cell line ATCC Cat. #: CRL2407 K562 human leukemic cell line ATCC Cat. #: CCL-243 Experimental models: Organisms/strains Mouse: C57BL/6J Gift from E. Deenick (Garvan Institute of Medical Research) N/A Mouse: C57BL/6 OT-I x Lifeact-EGFP Galeano Niño et al.19,27 N/A Mouse: C57BL/6 OT-I x TdTomato Galeano Niño et al.19,27; Muzumdar et al.45 N/A Mouse: NOD.CgPrkdcIL2rg/SzJAusb (NSG) Jackson Laboratory Strain #:005557; RRID:IMSR_JAX:005557 Oligonucleotides RT-qPCR primers used in this study are listed in Table S3 Bio-Rad Laboratories N/A Recombinant DNA Rae1β-mTagBFP and mTagBFP2-OVAAg85b gBlocks Integrated DNA Technologies Inc N/A Software and algorithms BD FACSDiva version 7 BD Biosciences N/A FlowJo version 10.2 Treestar Inc N/A Prism 9.5.1 GraphPad Software N/A Imaris version 9.2.1 Bitplane AG N/A MATLAB version 2018b Mathworks Inc N/A Algorithms to generate ‘M’ metric Galeano Niño et al.19,27; Hywood et al.25 N/A Biostitch Vaskivskyi et al.46 N/A Cellpose (Stringer et al.47) N/A Qupath 0.5.1 (Bankhead et al.48) N/A Other AccuCount Blank Particles Spherotech Cat. #: ACBP-70-10 Sensoplate Microplate, 96 well, PS, F-bottom Greiner Cat. #: 655892 35 mm Dish | No. 1.5 Coverslip | 14 mm Glass Diameter | Uncoated Mattek Cat. #: P35G-1.5-14-C Transwell inserts: 5 μm pore size polycarvbonate 6.5mm diameter membrane inserts Costar Cat. #: 3421 Cyto-Fast Fix/Perm Buffer Set BioLegend Cat. #: 426803 (Continued on next page) 14 Cell Reports 45, 117415, June 23, 2026 ..

Quantitative RT-PCR:

Article Title: Natural killer cells swarm and cross-recruit cytotoxic T cells via CCR5.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays NK Cell Isolation Kit, mouse Miltenyi Biotec Cat. #. .. 130-115-818 EasySep Human CD3 Positive Selection Kit II StemCell Technologie Cat. #: 17851 LEGENDplex Multi-Analyte Flow Assay Kit Biolegend Cat. #: 740451 LegendPlex Human Proinflammatory Chemokine panel Biolegend Cat. #: 741081 LegendPlex Human CD8/NK panel BioLegend Cat. #: 741187 RNeasy Mini Kit Qiagen Cat. #: 17854 Experimental models: Cell lines Murine EL4 lymphoma ATCC Cat. #: TIB-39TM Murine EL4-Rae1β This paper N/A Murine EL4-Rae1β-OVA This paper N/A Murine YAC-1 lymphoblast Gift from N. Huntington (Monash University) N/A NK-92 human NK cell line ATCC Cat. #: CRL2407 K562 human leukemic cell line ATCC Cat. #: CCL-243 Experimental models: Organisms/strains Mouse: C57BL/6J Gift from E. Deenick (Garvan Institute of Medical Research) N/A Mouse: C57BL/6 OT-I x Lifeact-EGFP Galeano Niño et al.19,27 N/A Mouse: C57BL/6 OT-I x TdTomato Galeano Niño et al.19,27; Muzumdar et al.45 N/A Mouse: NOD.CgPrkdcIL2rg/SzJAusb (NSG) Jackson Laboratory Strain #:005557; RRID:IMSR_JAX:005557 Oligonucleotides RT-qPCR primers used in this study are listed in Table S3 Bio-Rad Laboratories N/A Recombinant DNA Rae1β-mTagBFP and mTagBFP2-OVAAg85b gBlocks Integrated DNA Technologies Inc N/A Software and algorithms BD FACSDiva version 7 BD Biosciences N/A FlowJo version 10.2 Treestar Inc N/A Prism 9.5.1 GraphPad Software N/A Imaris version 9.2.1 Bitplane AG N/A MATLAB version 2018b Mathworks Inc N/A Algorithms to generate ‘M’ metric Galeano Niño et al.19,27; Hywood et al.25 N/A Biostitch Vaskivskyi et al.46 N/A Cellpose (Stringer et al.47) N/A Qupath 0.5.1 (Bankhead et al.48) N/A Other AccuCount Blank Particles Spherotech Cat. #: ACBP-70-10 Sensoplate Microplate, 96 well, PS, F-bottom Greiner Cat. #: 655892 35 mm Dish | No. 1.5 Coverslip | 14 mm Glass Diameter | Uncoated Mattek Cat. #: P35G-1.5-14-C Transwell inserts: 5 μm pore size polycarvbonate 6.5mm diameter membrane inserts Costar Cat. #: 3421 Cyto-Fast Fix/Perm Buffer Set BioLegend Cat. #: 426803 (Continued on next page) 14 Cell Reports 45, 117415, June 23, 2026 ..

Pore Size:

Article Title: Natural killer cells swarm and cross-recruit cytotoxic T cells via CCR5.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays NK Cell Isolation Kit, mouse Miltenyi Biotec Cat. #. .. 130-115-818 EasySep Human CD3 Positive Selection Kit II StemCell Technologie Cat. #: 17851 LEGENDplex Multi-Analyte Flow Assay Kit Biolegend Cat. #: 740451 LegendPlex Human Proinflammatory Chemokine panel Biolegend Cat. #: 741081 LegendPlex Human CD8/NK panel BioLegend Cat. #: 741187 RNeasy Mini Kit Qiagen Cat. #: 17854 Experimental models: Cell lines Murine EL4 lymphoma ATCC Cat. #: TIB-39TM Murine EL4-Rae1β This paper N/A Murine EL4-Rae1β-OVA This paper N/A Murine YAC-1 lymphoblast Gift from N. Huntington (Monash University) N/A NK-92 human NK cell line ATCC Cat. #: CRL2407 K562 human leukemic cell line ATCC Cat. #: CCL-243 Experimental models: Organisms/strains Mouse: C57BL/6J Gift from E. Deenick (Garvan Institute of Medical Research) N/A Mouse: C57BL/6 OT-I x Lifeact-EGFP Galeano Niño et al.19,27 N/A Mouse: C57BL/6 OT-I x TdTomato Galeano Niño et al.19,27; Muzumdar et al.45 N/A Mouse: NOD.CgPrkdcIL2rg/SzJAusb (NSG) Jackson Laboratory Strain #:005557; RRID:IMSR_JAX:005557 Oligonucleotides RT-qPCR primers used in this study are listed in Table S3 Bio-Rad Laboratories N/A Recombinant DNA Rae1β-mTagBFP and mTagBFP2-OVAAg85b gBlocks Integrated DNA Technologies Inc N/A Software and algorithms BD FACSDiva version 7 BD Biosciences N/A FlowJo version 10.2 Treestar Inc N/A Prism 9.5.1 GraphPad Software N/A Imaris version 9.2.1 Bitplane AG N/A MATLAB version 2018b Mathworks Inc N/A Algorithms to generate ‘M’ metric Galeano Niño et al.19,27; Hywood et al.25 N/A Biostitch Vaskivskyi et al.46 N/A Cellpose (Stringer et al.47) N/A Qupath 0.5.1 (Bankhead et al.48) N/A Other AccuCount Blank Particles Spherotech Cat. #: ACBP-70-10 Sensoplate Microplate, 96 well, PS, F-bottom Greiner Cat. #: 655892 35 mm Dish | No. 1.5 Coverslip | 14 mm Glass Diameter | Uncoated Mattek Cat. #: P35G-1.5-14-C Transwell inserts: 5 μm pore size polycarvbonate 6.5mm diameter membrane inserts Costar Cat. #: 3421 Cyto-Fast Fix/Perm Buffer Set BioLegend Cat. #: 426803 (Continued on next page) 14 Cell Reports 45, 117415, June 23, 2026 ..

Membrane:

Article Title: Natural killer cells swarm and cross-recruit cytotoxic T cells via CCR5.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Critical commercial assays NK Cell Isolation Kit, mouse Miltenyi Biotec Cat. #. .. 130-115-818 EasySep Human CD3 Positive Selection Kit II StemCell Technologie Cat. #: 17851 LEGENDplex Multi-Analyte Flow Assay Kit Biolegend Cat. #: 740451 LegendPlex Human Proinflammatory Chemokine panel Biolegend Cat. #: 741081 LegendPlex Human CD8/NK panel BioLegend Cat. #: 741187 RNeasy Mini Kit Qiagen Cat. #: 17854 Experimental models: Cell lines Murine EL4 lymphoma ATCC Cat. #: TIB-39TM Murine EL4-Rae1β This paper N/A Murine EL4-Rae1β-OVA This paper N/A Murine YAC-1 lymphoblast Gift from N. Huntington (Monash University) N/A NK-92 human NK cell line ATCC Cat. #: CRL2407 K562 human leukemic cell line ATCC Cat. #: CCL-243 Experimental models: Organisms/strains Mouse: C57BL/6J Gift from E. Deenick (Garvan Institute of Medical Research) N/A Mouse: C57BL/6 OT-I x Lifeact-EGFP Galeano Niño et al.19,27 N/A Mouse: C57BL/6 OT-I x TdTomato Galeano Niño et al.19,27; Muzumdar et al.45 N/A Mouse: NOD.CgPrkdcIL2rg/SzJAusb (NSG) Jackson Laboratory Strain #:005557; RRID:IMSR_JAX:005557 Oligonucleotides RT-qPCR primers used in this study are listed in Table S3 Bio-Rad Laboratories N/A Recombinant DNA Rae1β-mTagBFP and mTagBFP2-OVAAg85b gBlocks Integrated DNA Technologies Inc N/A Software and algorithms BD FACSDiva version 7 BD Biosciences N/A FlowJo version 10.2 Treestar Inc N/A Prism 9.5.1 GraphPad Software N/A Imaris version 9.2.1 Bitplane AG N/A MATLAB version 2018b Mathworks Inc N/A Algorithms to generate ‘M’ metric Galeano Niño et al.19,27; Hywood et al.25 N/A Biostitch Vaskivskyi et al.46 N/A Cellpose (Stringer et al.47) N/A Qupath 0.5.1 (Bankhead et al.48) N/A Other AccuCount Blank Particles Spherotech Cat. #: ACBP-70-10 Sensoplate Microplate, 96 well, PS, F-bottom Greiner Cat. #: 655892 35 mm Dish | No. 1.5 Coverslip | 14 mm Glass Diameter | Uncoated Mattek Cat. #: P35G-1.5-14-C Transwell inserts: 5 μm pore size polycarvbonate 6.5mm diameter membrane inserts Costar Cat. #: 3421 Cyto-Fast Fix/Perm Buffer Set BioLegend Cat. #: 426803 (Continued on next page) 14 Cell Reports 45, 117415, June 23, 2026 ..



Similar Products

86
Dotmatics Limited graphpad prism dotmatics
Graphpad Prism Dotmatics, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad/graphpad+prism/pm42268716-582-220-222
Average 86 stars, based on 1 article reviews
graphpad prism dotmatics - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Tree Star Inc algorithms graphpad prism
Algorithms Graphpad Prism, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad/flowjo10/pm42268710-553-201-212
Average 86 stars, based on 1 article reviews
algorithms graphpad prism - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Deepmind Technologies Ltd algorithms prism 8 0 graphpad
Algorithms Prism 8 0 Graphpad, supplied by Deepmind Technologies Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad/1+10+3+algorithms+graphpad+graphpad+prism+software/pm42228568-188-165-178
Average 86 stars, based on 1 article reviews
algorithms prism 8 0 graphpad - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Tree Star Inc algorithms graphpad prism version 9 5 1 graphpad
Algorithms Graphpad Prism Version 9 5 1 Graphpad, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad/flowjo10/pm42166330-192-5-19
Average 86 stars, based on 1 article reviews
algorithms graphpad prism version 9 5 1 graphpad - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Dotmatics Limited graphpad by dotmatics
Graphpad By Dotmatics, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad/by+dotmatics+graphpad/pmc13050503-99-10-12
Average 86 stars, based on 1 article reviews
graphpad by dotmatics - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Dotmatics Limited algorithms graphpad prism dotmatics
Algorithms Graphpad Prism Dotmatics, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad/graphpad+prism/pm41903141-212-194-197
Average 86 stars, based on 1 article reviews
algorithms graphpad prism dotmatics - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Deepmind Technologies Ltd algorithms graphpad prism 10 4 1 graphpad software
Algorithms Graphpad Prism 10 4 1 Graphpad Software, supplied by Deepmind Technologies Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad/1+10+3+algorithms+graphpad+graphpad+prism+software/pm41903133-211-97-117
Average 86 stars, based on 1 article reviews
algorithms graphpad prism 10 4 1 graphpad software - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

99
New England Biolabs e2621 software graphpad prism 9
E2621 Software Graphpad Prism 9, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad/NEBuilder+HiFi+DNA+Assembly+Master+Mix/pm41872551-248-303-298
Average 99 stars, based on 1 article reviews
e2621 software graphpad prism 9 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Deepmind Technologies Ltd algorithms graphpad prism 10 3 1 graphpad software
Algorithms Graphpad Prism 10 3 1 Graphpad Software, supplied by Deepmind Technologies Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad/1+10+3+algorithms+graphpad+graphpad+prism+software/pm41824449-733-235-256
Average 86 stars, based on 1 article reviews
algorithms graphpad prism 10 3 1 graphpad software - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Biognosys algorithms prism graphpad software
Algorithms Prism Graphpad Software, supplied by Biognosys, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/graphpad/algorithms+graphpad+prism+software/pm41747732-295-59-89
Average 86 stars, based on 1 article reviews
algorithms prism graphpad software - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results